Request iPSC cell lines

WashU Medicine Pediatric Center of Excellence in Nephrology

Credit: Kyle McCracken, P&F awardee

Use iPSC cell lines and organoids to model pediatric kidney disease, discover developmental mechanisms, rebuild kidneys or reengineer nephron segments, and screen for new drug treatments for kidney injury or failure.

We are now able to offer the first vial of each human iPSC cell lines at no charge and the second vial of the same cell line for $250.00.

The recipient will be responsible for shipping costs. Requires membership in WashU Medicine PCEN.

Through collaborative efforts from multiple entities, human iPSC parental and reporter lines are now accessible to the research community. These tools are designed to enhance studies that optimize existing or new protocols aimed at target kidney lineages, adapt differentiation techniques to various contexts (e.g., bioprinting or scaffold seeding), or monitor cell identity maintenance under different culture conditions. The reporter iPSC lines are designed to identify specific kidney cell populations in organoids using various fluorescent proteins, with some versions including cell-specific Cre recombinase expression for cell lineage tracing. Applications also include the engineering of replacement kidneys and research in preclinical model systems.

Costs

Human induced pluripotent stem cells (HiPSCs) are now subsidized by grants from the Kidney Translational Research Center (KTRC) and WashU Medicine PCEN (P50DK133943). These sources should be cited in publications and presentations (refer to the “Acknowledgements” section for full citation information).

ResearcherFirst vial costSubsequent vial costOverheadsShipping fees
Pediatric nephrology research (PCEN members)Free$25020% of vial costPaid by receiver
Non-pediatric research$450$45020% of vial costPaid by receiver

The first vial of each human iPSC cell line is available at no charge, and the second vial of the same cell line can be obtained for $250.

Recipients will automatically become members of the WashU Medicine PCEN, which aims to generate a multimodal molecular atlas of the mouse and human kidney throughout the pediatric lifespan. Membership includes access to PCEN grant announcements, educational and enrichment activities, collaborative opportunities, and core facilities. If a recipient does not wish to join the WashU Medicine PCEN, they must notify the KTRC and will be charged $540 for the first vial of each line. Shipping costs remain the recipient’s responsibility.

Investigators may request as many lines as needed for their research at no cost, but only three lines will be shipped to the same investigator within a three-month period to ensure the benefit is available to others throughout the year.

Requests are made via links that facilitate connection with the donating laboratory and the cell distribution center.

Cell lines are stored in the PCEN repository at the WashU Medicine Kidney Translational Research Center (KTRC).

Note for International Requests Pricing for vials is consistent globally; however, international shipping incurs higher costs. Shipments are typically made via World Courier, which is reliable but more expensive. Up to three cell lines can be shipped together, provided all necessary documentation is in order.

Requesting a cell line

The process for requesting a cell line is as follows:

  1. Look through our available cell lines listed below.
  2. For a cell line you would like to request, click the Request link on the cell line record or use the link below.
  3. You will receive an email with the contact information for the cell line provider.
  4. The KTRC will send you an initial email with instructions on completing and submitting all approval documentation and how to obtain the materials transfer agreement (MTA) for the requested cell line.
  5. After all forms have been returned and approved, and a fully executed MTA has been emailed to the KTRC, shipping arrangements will be agreed upon and scheduled. The requester is responsible for all shipping costs.

Please allow 4-6 weeks for the entire process of requesting, approvals and shipping.

Acknowledging use of cell lines

Please cite the following in your publications and presentations:

Made possible by the Kidney Translational Research Center (KTRC) and the ATLAS D2K (U24DK135157) and WashU Medicine PCEN (P50DK133943) grants.

Also please cite the following RBK publication:

Oxburgh L, Carroll TJ, Cleaver O, Gossett DR, Hoshizaki DK, Hubbell JA, Humphreys BD, Jain S, Jensen J, Kaplan DL, Kesselman C, Ketchum CJ, Little MH, McMahon AP, Shankland SJ, Spence JR, Valerius MT, Wertheim JA, Wessely O, Zheng Y, Drummond IA. (Re)Building a Kidney. J Am Soc Nephrol. 2017 May;28(5):1370-1378. doi: 10.1681/ASN.2016101077. Epub 2017 Jan 17. PMID: 28096308; PMCID: PMC5407737.

Request a cell line

Request now

Parental cell lines

RID Name Action Organism Cell line type Transient modification Donor ethnicity Donor stage Donor age Donor sex Pluripotency Germ layer staining Sequenced Tissue Anatomy name Organ Anatomy name 1 Reference source Precursor cell name Passage number Made At Kidney organoids status Comments Release date Curation Status Principal investigator Consortium
Q-2D6T iPSC line CRL1502 (clone C32) Homo sapiens hiPSC Episomal 12 weeks, 0 days Female True UBERON:0002097 skin of body UBERON:0002097 skin of body Murdoch Children’s Research Institute Murdoch Children’s Research Institute Made This iPSC lines was used to create organoids in Takasato, M., Er, P.X., Chiu, H.S., Maier, B., Baillie, G.J., Ferguson, C., Parton, R.G., Wolvetang, E.J., Roost, M.S., Chuva de Sousa Lopes, S.M., et al. (2015). Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis. Nature 526, 564–568. pubmed.gov/26444236. 2017-09-14 14:48:20.912806 Release Melissa H. Little, MCRI RBK
Q-2D6W BJFF6 Request Homo sapiens hiPSC Sendai virus White Male True False True gudmap-rbk:14-6XJR BJ foreskin fibroblasts Stemgent Made P6 foreskin fibroblasts, healthy male; The fibroblasts were received free from Stemgent (BJ) in 2011 in a training seminar, the iPSC line made at WU 2017-06-07 20:10:25.49997 Release Sanjay Jain, WashU Medicine RBK
Q-2D6Y WTC11 Request Homo sapiens hiPSC Episomal Asian Male True True True gudmap-rbk:14-6XA0 leg fibroblasts Conklin Lab, Gladstone Institute In Process WU has a stock. WTC11 has been WES 30X. WGS 4X; WGS 100X pending by Allen institute. The tracks can be seen [here](http://labs.gladstone.ucsf.edu/conklin/pages/genomic-sequence-data-and-rna-sequence-ips-cells) 2017-06-07 20:10:25.49997 Release Sanjay Jain, WashU Medicine RBK
Q-2D70 WTC11-GCaMP6 Request Homo sapiens hiPSC Episomal Asian Male True True True gudmap-rbk:14-6XA0 leg fibroblasts Conklin Lab, Gladstone Institute In Process WU has a stock. The parent line is WTC11 WTC11 has been WES 30X. WGS 4X; WGS pending 100X by Allen institute. The tracks can be seen [here](http://labs.gladstone.ucsf.edu/conklin/pages/genomic-sequence-data-and-rna-sequence-ips-cells). GCaMP6f was introduced in the AAVS1 locus using TALENs 2017-06-07 20:10:25.49997 Release Sanjay Jain, WashU Medicine RBK
Q-2D72 AN1.1 Request Homo sapiens hiPSC Sendai virus White Female True True True gudmap-rbk:14-6X8W urine cells In Process Healthy adult female 2017-06-07 20:10:25.49997 Release Sanjay Jain, WashU Medicine RBK

Reporter cell lines

RID Name Request Genotype Source line Parental line Reporter category Donor Status Sex Organism Cell line type Targeting approach Reporter Cas9 protospacer Karyotype molecular Principal investigator
14-3QDC GATA3:mCherry Request hetero foreskin fibroblasts CRL-2429 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA mCherry CGAGGCCATGGAGGTGACGG Normal Melissa H. Little, MCRI
14-3QDG MAFB:mTagBFP2/GATA3:mCherry Request hetero/hetero MAFBmTagBFP2 iPSCs MAFBmTagBFP2 iPSCs Multiple Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA mTagBFP2 and mCherry CGAGGCCATGGAGGTGACGG Normal Melissa H. Little, MCRI
14-3QDM SIX2:EGFP Request homo foreskin fibroblasts CRL-2429 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA EGFP GTCAGCCAACCTCGTGGACC Normal Melissa H. Little, MCRI
14-3QDR SIX2:EGFP/CITED1:mCherry Request homo/hemi SIX2:EGFP iPSCs SIX2:EGFP iPSCs Multiple Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA EGFP and mCherry TGCCAAGTGTCCCTAAAGA Not Performed Melissa H. Little, MCRI
16-1YZG HNF4A:YFP Request homo foreskin fibroblasts PCS­-201-­010 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA YFP TTCCCCACTGTGCCGCTTT Normal Melissa H. Little, MCRI
16-1YZT SIX2:Cre/GAPDH:Dual Request homo/hetero foreskin fibroblasts SIX2:Cre iPSCs (clone 60) Multiple Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA loxP-flanked EGFP adjacent to mCherry CTTCCTCTTGTGCTCTTGCT Normal Melissa H. Little, MCRI
16-DYT2 LRP2:mTagBFP2 Request hetero foreskin fibroblasts CRL-2429 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA mTagBFP2 GGAGTTGGGTCTCTTCTCGA Normal Melissa H. Little, MCRI
16-DYTA SIX2:CreERT2/GAPDH:Dual Request homo/hetero foreskin fibroblasts CRL-2429 foreskin fibroblasts Multiple Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA loxP-flanked EGFP adjacent to mCherry CTTCCTCTTGTGCTCTTGCT Normal Melissa H. Little, MCRI
16-E08J SIX2:Cre Request homo CRL-2429 fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA Cre recombinase TCAGCCAACCTCGTGGACC Normal Melissa H. Little, MCRI
16-E08P SIX2:CreERT2 Request homo CRL-2429 fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA CreERT2 TCAGCCAACCTCGTGGACC Normal Melissa H. Little, MCRI
Q-2CW0 hRETtdTomato:GCaMP6f Request WTC11-GCaMP6f WTC11 Multiple Healthy donor Homo sapiens hiPSC CRISPR/Cas9/gRNA tdTomato;GCaMP6f (calcium activated GFP) GCCCCAGCGCGCACGGGCGA Not Performed Sanjay Jain, WashU Medicine
Q-2CW2 MAFB:mTagBFP2 Request hetero foreskin fibroblasts CRL-2429 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA mTagBFP2 CTCGCTTCAGCGATGGCCG Normal Melissa H. Little, MCRI
Q-2CW4 CITED1:mCherry Request hemi foreskin fibroblasts CRL-2429 foreskin fibroblasts Single Healthy donor Male Homo sapiens hiPSC CRISPR/Cas9/gRNA Knockin of T2A-mCherry cassette (no selection) TGCCAAGTGTCCCTAAAGA Normal Melissa H. Little, MCRI